single strand dna oligonucleotide probes  (Thermo Fisher)

Journal: Disease models & mechanisms

Article Title: Altered binding affinity of SIX1-Q177R correlates with enhanced WNT5A and WNT pathway effector expression in Wilms tumor.

doi: 10.1242/dmm.050208

Figure Lengend Snippet: Fig. 6. SIX1-Q177R binds the core DNA motif sequence within the WNT5A promoter ChIP-seq peak with a higher affinity than SIX1. (A,B) Top: chemiluminescence EMSA images of purified recombinant SIX1 and SIX1-Q177R protein at concentrations as indicated, together with biotin-labeled oligonucleotide probes containing the core probe DNA motif sequences (shown above), derived from wild-type WNT5A promoter ChIP-seq peak (A) and mutated WNT5A promoter ChIP-seq peak (B). Bottom: quantification of EMSA-derived DNA-protein binding data determined from signal intensities of bound and unbound probe by using ImageJ software.

Article Snippet: Electrophoretic mobility shift assays Single-stranded DNA oligonucleotide probes were synthesized by IDT and then biotin end-labeled using the Pierce 3′ Biotin end-labeling DNA kit (Thermo Scientific) following the manufacturer’s protocol with the following changes: 25 pmol oligonucleotide per reaction were labeled, reactions stopped with 1 μl 0.5M EDTA after 30 min. Complementary oligonucleotide labeling reactions were mixed prior to centrifugation at 13,000 g for 2 min. For unlabeled oligonucleotides, 50 μl H2O was mixed with 25 μl of each complementary 100 μM oligonucleotide.

Techniques: Sequencing, ChIP-sequencing, Purification, Recombinant, Labeling, Derivative Assay, Protein Binding, Software

Journal: Advanced Materials Technologies

Article Title: 3D‐Printed SARS‐CoV‐2 RNA Genosensing Microfluidic System

doi: 10.1002/admt.202101121

Figure Lengend Snippet: Scheme of the lab‐on‐a‐chip genosensor for SARS‐CoV‐2 virus detection. 3D‐printed electrodes were fabricated using a 3D printing pen (3D‐PP) and a conductive graphene/polylactic acid (PLA) filament. The antisense ssDNA probe was adsorbed on the 3D‐PP surface. SARS‐CoV‐2 RNA is monitored by decreasing of adenine oxidation signal when SARS‐CoV‐2 RNA adducts antisense ssDNA probe from 3D‐PP surface.

Article Snippet: RNA fragment of SARS‐CoV‐2 sequence (target, 5′‐ACACCAAAAGAUCACAUUGG), antisense oligonucleotide (single‐strand DNA probe, 5′‐CCAATGTGATCTTTTGGTGT), single base‐mismatched RNA (5′‐ACACCAAACGAUCACAUUGG), total mismatched ssDNA (5′‐GCAGTTGATCCTTTGGATACCCTGG), phosphate buffered saline (PBS) tablets, tri‐sodium citrate dehydrate (purity >99%), K 4 Fe(CN) 6 (purity >98.5%), K 3 Fe(CN) 6 (purity >99%), and sodium hypochlorite solution were purchased in Sigma‐Aldrich (Darmstadt, Germany).

Techniques: Lab-on-a-Chip

Journal: Advanced Materials Technologies

Article Title: 3D‐Printed SARS‐CoV‐2 RNA Genosensing Microfluidic System

doi: 10.1002/admt.202101121

Figure Lengend Snippet: A) DPV curves corresponding to (c) activated 3D‐PP, (a) ssDNA antisense oligonucleotide of SARS‐COV‐2 absorbed on 3D‐PP genosensor and (b) 3D‐PP genosensor incubated with 500 × 10 −9 m SARS‐COV‐2 RNA solution. DPV conditions: Pulse amplitude 50 mV, step potential 10 mV, scan rate 20 mV s –1 PBS pH 7.4. B) Calibration curve: Inverse peak area versus SARS‐CoV‐2 RNA concentration.

Article Snippet: RNA fragment of SARS‐CoV‐2 sequence (target, 5′‐ACACCAAAAGAUCACAUUGG), antisense oligonucleotide (single‐strand DNA probe, 5′‐CCAATGTGATCTTTTGGTGT), single base‐mismatched RNA (5′‐ACACCAAACGAUCACAUUGG), total mismatched ssDNA (5′‐GCAGTTGATCCTTTGGATACCCTGG), phosphate buffered saline (PBS) tablets, tri‐sodium citrate dehydrate (purity >99%), K 4 Fe(CN) 6 (purity >98.5%), K 3 Fe(CN) 6 (purity >99%), and sodium hypochlorite solution were purchased in Sigma‐Aldrich (Darmstadt, Germany).

Techniques: Incubation, Concentration Assay

Journal: Advanced Materials Technologies

Article Title: 3D‐Printed SARS‐CoV‐2 RNA Genosensing Microfluidic System

doi: 10.1002/admt.202101121

Figure Lengend Snippet: A) Digital photograph of lab on a chip system composed by PDMS microchannel and electrochemical cell composed of three electrodes fabricated by 3D‐PP. Electrodes were placed in the outlet reservoir as well as the schematic representation of the PDMS channel. This scheme shows 3D‐printed electrodes position in the microfluidic device. Working electrode (WE) was set inside the microchip reservoir, just at the outlet of the microchannel. Reference (RE) and counter (CE) electrodes were placed in the electrochemical cell. B) Peak area obtained for a) 3D‐PP modified with antisense ssDNA probe of SARS‐CoV‐2 and b) in presence of 200 × 10 −9 m SARS‐CoV‐2 RNA.

Article Snippet: RNA fragment of SARS‐CoV‐2 sequence (target, 5′‐ACACCAAAAGAUCACAUUGG), antisense oligonucleotide (single‐strand DNA probe, 5′‐CCAATGTGATCTTTTGGTGT), single base‐mismatched RNA (5′‐ACACCAAACGAUCACAUUGG), total mismatched ssDNA (5′‐GCAGTTGATCCTTTGGATACCCTGG), phosphate buffered saline (PBS) tablets, tri‐sodium citrate dehydrate (purity >99%), K 4 Fe(CN) 6 (purity >98.5%), K 3 Fe(CN) 6 (purity >99%), and sodium hypochlorite solution were purchased in Sigma‐Aldrich (Darmstadt, Germany).

Techniques: Lab-on-a-Chip, MicroChIP Assay, Modification